The LacZ short range PCR detects the presence of the LacZ reporter in the cassette in the tm1a form of the EUCOMM / KOMP allele. This can be used as a rapid screen on F1 chimera progeny samples to detect likely germ line transmission. The WTSI genotyping assay is shown below. Once putative GLT has been detected, additional gene-specific assays and quality control tests can be performed (see www.knockoutmouse.org/kb/25/. for more information)
| Assay |
5’ Forward Name |
5’ Forward Sequence |
3’ Reverse Name |
3’ Reverse Sequence |
Product size |
| LacZ |
LacZ_2_small_F |
ATCACGACGCGCTGTATC |
LacZ_2_small_R |
ACATCGGGCAAATAATATCG |
108bp |
.jpg)