The LacZ short range PCR detects the presence of the LacZ reporter in the cassette. This can be used as a rapid screen on F1 chimera progeny samples to detect likely germ line transmission. The WTSI genotyping assay is shown below
| Assay |
5’ Forward Name |
5’ Forward Sequence |
3’ Reverse Name |
3’ Reverse Sequence |
Product size |
| LacZ |
LacZ_2_small_F |
ATCACGACGCGCTGTATC |
LacZ_2_small_R |
ACATCGGGCAAATAATATCG |
108bp |
